Crop sequences using delimiting patterns

Crop sequences using delimiting patterns

seq_crop_pattern(
  x,
  pattern_in,
  pattern_out,
  max_error_in = 0,
  max_error_out = 0,
  include_patterns = TRUE
)

Arguments

x

a DNA, RNA or AA vector to be cropped.

pattern_in

patterns defining the beginning (left-side).

pattern_out

patterns defining the end (right-side).

max_error_in, max_error_out

numeric values ranging from 0 to 1 and giving the maximum error rate allowed between the target sequence and pattern_in/pattern_out. Error rate is relative to the length of the pattern.

include_patterns

logical. Should the matched pattern sequence included in the returned sequences?

Value

A cropped DNA, RNA or AA vector. Sequences where patterns are not detected returns NA.

Fuzzy matching

When max_error_in or max_error_out are greater than zero, the function perform fuzzy matching. Fuzzy matching does not support regular expression.

Patterns

It is important to understand how patterns are treated in bioseq.

Patterns are recycled along the sequences (usually the x argument). This means that if a pattern (vector or list) is of length > 1, it will be replicated until it is the same length as x. The reverse is not true and a vector of patterns longer than a vector of sequences will raise a warning.

Patterns can be DNA, RNA or AA vectors (but they must be from the same class as the sequences they are matched against). If patterns are DNA, RNA or AA vectors, they are disambiguated prior to matching. For example pattern dna("ARG") will match AAG or AGG.

Alternatively, patterns can be a simple character vector containing regular expressions.

Vectors of patterns (DNA, RNA, AA or regex) can also be provided in a list. In that case, each vector of the list will be collapsed prior matching, which means that each vector element will be used as an alternative pattern. For example pattern list(c("AAA", "CCC"), "GG") will match AAA or CCC in the first sequence, GG in the second sequence, AAA or CCC in the third, and so on following the recycling rule.

@section Fuzzy matching: When max_error is greater than zero, the function perform fuzzy matching. Fuzzy matching does not support regular expression.

See also

stri_extract from stringi, str_extract from stringr and afind from stringdist for the underlying implementation.

Other string operations: seq-replace, seq_combine(), seq_count_pattern(), seq_crop_position(), seq_detect_pattern(), seq_extract_pattern(), seq_extract_position(), seq_remove_pattern(), seq_remove_position(), seq_replace_position(), seq_split_kmer(), seq_split_pattern()

Examples

x <- dna("ACGTTAAAAAGTGTAGCCCCCGT", "CTCGAAATGA")
seq_crop_pattern(x, pattern_in = "AAAA", pattern_out = "CCCC")
#> DNA vector of 2 sequences
#> >   AAAAAGTGTAGCCCCC
#> >   NA